Extension:DNASeq

MediaWiki extensions manual
OOjs UI icon advanced.svg
DNASeq
Release status: unmaintained
Implementation Tag
Description Displays a DNA Sequence
Author(s) Pierre Lindenbaum
Latest version 1.0 (2009-01-04)
MediaWiki Tested on 1.13.3
License No license specified
Download see below
Check usage and version matrix.

This Mediawiki extension enables you to display a DNA Sequence.

ScreenshotEdit

 

UsageEdit

<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca
N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>

SourceEdit

The source is available here: https://code.google.com/p/lindenb/source/browse/trunk/proj/mediawiki/extensions/dnaseq/dnaseq.php

another version , proposed by Niklas Laxström

InstallationEdit

Add...

require_once("$IP/extensions/dnaseq/dnaseq.php");

...to your LocalSettings.php file.

and copy the source to $IP/extensions/dnaseq/dnaseq.php

ReferenceEdit

To DoEdit

CSS, base indexing, sending to blast...