Open main menu

Extension:DNASeq

MediaWiki extensions manual
OOjs UI icon advanced.svg
DNASeq
Release status: stable
Implementation Tag
Description Displays a DNA Sequence
Author(s) Pierre Lindenbaum
Latest version 1.0 (2009-01-04)
MediaWiki Tested on 1.13.3
License No license specified
Download see below
Translate the DNASeq extension if it is available at translatewiki.net
Check usage and version matrix.

This Mediawiki extension enables you to display a DNA Sequence.

ScreenshotEdit

 

UsageEdit

<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca
N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>

SourceEdit

InstallationEdit

Add...

require_once("$IP/extensions/dnaseq/dnaseq.php");

...to your LocalSettings.php file.

and copy the source to $IP/extensions/dnaseq/dnaseq.php

ReferenceEdit

To DoEdit

CSS, base indexing, sending to blast...